Molecular polymorphism Analysis on CD36 Deficiency among Platelet Blood Donors in Shenzhen / 中国实验血液学杂志

OBJECTIVE@#To analyze the molecular polymorphisms of CD36 among 58 blood donors with CD36 deficiency and compare with CD36 positive controls.@*METHODS@#A total of 58 donors with CD36 deficiency during a screening conducted in the laboratory from September 2019 to December 2020 were enrolled as the test group, including 39 males and 19 females, while 120 platelet donors with CD36 positive were randomly selected as the controls, including 76 males and 44 females. All of the subjects were Han nationality. The PCR-SBT method was used to detect coding region of CD36 gene, and molecular mutations were compared with those CD36 positive controls.@*RESULTS@#Among the 58 donors with CD36 deficiency, mutations appears in 32 individuals. The detection rate for type I was 71.43% (5/7), and type II was 51.92% (27/52), while among the 120 controls, mutations appears in 12 donors (10%). In the CD36 antigen-deficient donors, 16 variations were found, in which 329-330 del AC with the highest frequency accounted for 20.69%, followed by 1228-1239 del ATTGTGCCTATT(15.52%) and 1156 C>T(10.34%). Two variations, 198-205 del GATCTTTG and 220 C>T, led to premature termination of translation; four mutations, 329-330 del AC, 560 ins T, 1011-1049 39bp dupl and 1343-1344 ins TCTT, caused translation frame shift; 1228-1239 del ATTGTGCCTATT led to deletion of four amino acids (Ile-Val-Pro-Ile) at sites 410-413 of the peptide chain. The 1140 T>A and 1275 G>A were synonymous mutations, and the other 7 mutations resulted in the substitution of single nucleotide. The platelet expression in the donors of CD36 positive with 329-330 del AC or 1228-1239 del ATTGTGCCTATT mutation (heterozygote) was lower than those CD36 positive individuals without mutations (homozygote).@*CONCLUSION@#Multiple gene mutations in the CD36 coding region may cause CD36 deficiency, and the heterozygous individuals with mutations may lead to CD36 antigen reduction or deletion. Mutation is not detected in 44.83% of CD36 deficient individuals, there may be some other reasons for the CD36 antigen deficiency.

Research progress on pathogenesis of temporary osteoporosis in hip / 中国骨伤

Transient osteoporosis of the hip(TOH) is classified as a type of bone marrow edema syndrome. TOH is lack of previous study and there is still controversy about his pathogenesis. In recent years, with the development of multi-discipline, such as imaging, pathology, molecular biology, the study has found that the pathological mechanism is complex, while its mechanism is still not clear, which need further research. This paper summarizes the research progress on the pathogenesis of TOH from neurogenic, osteonecrosis, abnormal vascular function, subchondral fracture, heredity and regional acceleration and son on.

Establishment and Application of a Method for Determination of Glycosyltransferase Activity / 中国实验血液学杂志

<p><b>OBJECTIVE</b>To establish a method for determination of glycosyltransferase and to explore the enzyme A, B glycosyltransferase activity in human serum so as to lay the foundation for the determination of enzyme level and enzyme activity.</p><p><b>METHODS</b>The glycosyltransferase activity kit was used to draw phosphate standard curves in our laboratory. The A and B glycosyltransferase activity were determined by the standard curves.</p><p><b>RESULTS</b>The standard curves (y=2671.3x-0.596 R=0.9998) for determing glycosyltransferase activity suitable for use in our laboratory were drawn. At the same time the method was set up for determination of A, B glycosyltransferase in human serum.</p><p><b>CONCLUSION</b>The establised method of the determination of glycosyltransferase is suitable for common type of enzyme activity and suitable for the A, B glycosyltransferase in human serum.</p>

Polymorphism of M, N Allele in MN Blood Group of Chinese Population / 中国实验血液学杂志

<p><b>OBJECTIVE</b>To detect the base sequences of all exons and part of introns in the GYPA gene of the glycophorin GPA and to investigate the polymorphism of M, N alleles in Chinese population.</p><p><b>METHODS</b>A total of 225 blood sample were randomly colleeted from unrelated Chinese volunteers and were detected by serology techniques. The primers were designed by self, the seguencing of GYPA gene related with sample exon 1-7 full length sequences of bases and intron-1-7 partial sequence was performed, the polymorphism of M, N gene mutation in mucleotide sequence was analysed.</p><p><b>RESULTS</b>The results of M and N genotyping were in agreement with the results of serological detection. The 23rd base of intron-2, the 55th base of intron-3, the 63rd base of intron-4, the 55th, 189th and 190th base of intron-6, the 712th base variation of exon-7 in the gene M and N were used to subdivide the gene M and N into the mutant M103, M201, M202, N101, N102, N103, N104, and N201. At the same time, it was found that 42th and 54th base were mutated, the base T was inserted between 59th and 60th base in the intron-2, the new mutations occurred in the alleles 28, 29, 65 and 102 in intron-3 in this study.</p><p><b>CONCLUSION</b>The polymorphism of the the Chinese population's GYPA gene occurs in all the exons and partly in the introns. The gene polymorphism of M and N blood group in Chinese population might provide the theoretical basis for the studies of clinical blood transfusion, human population genetics and molecular biology.</p>

Correlation study between ~(18)F-FDG uptake and hypoxia inducible factor-1α level,microvessel density in human gliomas / 中华核医学杂志

Objective To investigate the correlation between ~(18)F-fluorodeoxyglucose (FDG) uptake and hypoxia inducible factor1α (HIF-1α) level,microvessel density (MVD) in human gliomas.Methods ~(18)F-FDG PET scan was performed preoperatively in 41 patients with gliomas (including 23 highgrade and 18 low-grade tumors).The ratios of maximum standardized uptake value(SUV_(max))between tumor (T)and contralateral white matter (WM) were calculated (T/WM).Immunohistochemical stain methods were used to evaluate the level of HIF-1α and measure the MVD in tumors.Correlation analysis between SUV_(max) of T/WM and HIF-1α level,MVD wag performed.The t-test,one-way ANOVA test,Spearman rank correlation and Wilcoxon signed-rank test were calculated using SPSS 11.5 software.Results (1)The SUV_(max) of T/WM,HIF-1α level and MVD in high-grade and low-grade tumors groups were 3.39±1.43,95.7% and 44.13±16.1 vs 1.46±0.55.55.6% and 18.83±7.07,respectively.The difierences of SUV_(max) of T/WM,HIF-1α level and MVD between two groups were statistically significant (t=-5.921,z=-3.938,t=-6.745,all P＜0.05).(2)Among 41 gliomas,the strong positive expression of HIF-1α was observed in 8,mederate in 9,weak in 15 and negative expression was found in 9,SUV_(max) of T/WM and MVD increased with increasing HIF-1α level.The differences of SUV_(max) of T/WM and MVD among 4 different groups were statistically significant (F=7.41,P＜0.05).(3) The MVD of all gliomas was ranged from 9.76 to 94.52,which correlated with SUV_(max) of T/WM(r=0.759,P＜0.05).Conclusions The SUV_(max) of T/WM correlates with HIF-1α level and MVD in gliomas.Therefore,~(18)F-FDG PET provides preoperatively a noninvasive assessment of hypoxia or angiogenesis in human glionma.

Establishment of an assay for cloning and sequencing the full-length HLA-Cw gene / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To establish a reliable assay for cloning and sequencing the full-length HLA-Cw gene.</p><p><b>METHODS</b>In this study, a fragment of 4.5 kb full-length HLA-Cw gene was amplified using the self-designed PCR primer pair by long template PCR, purified PCR products was cloned into the pGEM-Teasy plasmid vector and the plasmid DNA isolated from positive clones was subjected to haplotype sequencing by both directions. A total of 12 samples having been previously-genotyped by PCR sequence-based-typing (PCR-SBT) were amplified by using the TaKaRa LA Taq and Stratagene Pfu polymerase, respectively. PCR products of full length HLA-Cw gene were subjected to cloning and sequencing and the obtained haplotype sequence were compared with the PCR-SBT results.</p><p><b>RESULTS</b>The specific target fragment of HLA-Cw gene could be amplified and the full-length HLA-Cw allele sequence covering from nucleotide position -962 in 5'untranslated region (5'-UTR) to nucleotide position 3576 in downstream area of 3'-UTR region could be obtained using our method. The results of cloning and sequencing analysis indicated that the Stratagene Pfu polymerase had better fidelity than the TaKaRa LA Taq polymerase in this experiment. By comparing the sequences of Cw*07020101 with Cw*010201, 11 SNPs as well as 2 insertions/deletions in nt-962--284 of 5'-UTR, and 11 SNPs as well as 1 insertion/deletion in nt3067-3576 downstream of 3'-UTR were identified.</p><p><b>CONCLUSION</b>Our results indicate that the technique for cloning and sequencing full-length HLA-Cw gene has been established, it has a broad application in full-length HLA-Cw gene polymorphism study and the regulation and expression of HLA-Cw gene.</p>

Value of 18F-FDG and 11C-MET PET-CT in differentiation of brain ringlike-enhanced neoplastic and non-neoplastic lesions on MRI imaging / 中华肿瘤杂志

<p><b>OBJECTIVE</b>To evaluate the value of (18)F-FDG and (11)C-MET PET-CT scan in differentiation of brain ringlike-enhanced lesions on MRI imaging.</p><p><b>METHODS</b>Forty-one brain ringlike-enhanced lesions on MRI imaging including 30 brain tumors and 11 non-neoplastic lesions confirmed pathologically or clinically underwent (18)F-FDG and (11)C-MET PET-CT brain scan. Among them, 15 patients who were suspected to have brain metastasis received body scan by (18)F-FDG PET-CT. Both images were analyzed visually and semi-quantitatively.</p><p><b>RESULTS</b>Visual analysis: for brain tumors the diagnostic sensitivity, specificity and accuracy of (18)F-FDG PET-CT was 53.3%, 72.7%, 58.5%, versus 96.7%, 90.9%, 95.1% of (11)C-MET PET-CT, respectively. All the primary foci in 9 patients with brain metastases were detected by body (18)F-FDG PET-CT scan. Semiquantitative analysis: There was a significant difference in the uptake between highly differentiated malignant and poorly differentiated tumors as well as non-neoplastic lesions for both tracers (P < 0.01), while between low-grade malignant tumors and non-neoplasm lesions, there was a difference in uptake only by (11)C-MET (P < 0.01). No significant difference between the uptakes in brain metastasis and glioblastomas was found by both tracers (P > 0.05).</p><p><b>CONCLUSION</b>Both (18)F-FDG and (11)C-MET PET-CT are useful in differentiation of brain ringlike-enhanced lesions on MRI imaging. (11)C-MET PET-CT is more helpful than (18)F-FDG PET-CT in differential diagnosis of low-grade neoplastic from non-neoplastic lesions. Combination of (18)F-FDG and (11)C-MET PET-CT scans can improve the accuracy of differential diagnosis for brain ringlike-enhanced lesions on MRI imaging.</p>

Establishment of genotyping method for human platelet antigens of HPA-15 system by PCR-SSP / 中国实验血液学杂志

This study was aimed to establish the reliable genotyping method of human platelet antigens of HPA-15 system by PCR-SSP and to use this assay in the further HPA genotyping of volunteer platelet donors. 3 sequence-specific primers recommended by the 11th Platelet Genotyping and Serology Workshop on behalf of International Society of Blood Transfusion (ISBT) were synthesized. The concentration of each primer pair, the concentration of Mg(2+) and the PCR conditions were adjusted to optimize the conditions so that HPA-15 system could be specific amplified. The accuracy and reliability of the developed assay was evaluated and confirmed by typing the coded DNA samples provided by the 11th Platelet Genotyping and Serology Workshop. As a parallel control, a total of 50 volunteer platelet donors in Shenzhen were genotyped by both our assay and the G&T commercial kit at HPA-15 system. 10 coded samples distributed by the 11th Platelet Genotyping and Serology Workshop were genotyped by established PCR-SSP method. The results showed that a concordance rate of 100% was observed between the results obtained by established PCR-SSP method and the results provided by ISBT report. The HPA gene frequencies observed in 50 randomly-selected platelet donors in Shenzhen were 0.5100 and 0.4900 for HPA-15a and HPA-15b respectively. In conclusion, PCR-SSP assay established in our study provides a simple, rapid and accurate method for HPA-15 system genotyping, which assay is suitable for routine clinical HPA genotyping and shows a broad prospect in its further applications.

Application of 17 Y-chromosome specific STR loci in paternity testing / 中国实验血液学杂志

The purpose of this study was to explore the ability of discrimination of the AmpFlSTR Yfiler PCR amplification kit containing 17 Y-STR loci and the allelic mutation in the practice of paternity testing in Chinese population. 36 non-paternity father/son pairs and 84 confirmed father/son pairs, which had been previously genotyped by using Reliagene Y-PLEX 6 commercial kit and the "9 Y-STR multiplex with reduced-size amplicons" developed by our laboratory, were subjected to Y-STR genotyping at 17 loci using the AmpFlSTR Yfiler PCR amplification kit. 17 Y-STR loci were amplified in single multiplex and the PCR products were detected by using ABI Prism 3100 DNA Sequencer. The number of Y-STR exclusion for each non-paternity father/son pair and the mutation events for each confirmed father/son pair were calculated and the observed results were compared with our previous reported data determined by Reliagene Y-PLEX 6 kit and the "9 Y-STR multiplex with reduced-size amplicons". The results showed that out of 36 non-paternity father/son pairs subjected to Y-STR genotyping by using the AmpFlSTR Yfiler kit, one case with no Y-STR exclusion of paternity and 35 cases with more than 3 Y-STR exclusions for each father/son pair were observed. The percentage of cases with more than 3 Y-STR exclusions in all the tested non-paternity cases for Yfiler kit was 97.22% (35/36), which was more than that of Reliagene Y-PLEX 6 kit (92.11%, 35/38) and our "9 Y-STR multiplex with reduced-size amplicons" (91.67%, 33/36). Except for single father/son pair with no Y-STR exclusion, an average of 11.3 Y-STR exclusions was observed in other 35 non-paternity father/son pairs. In the 84 confirmed father/son pairs, 5 mutation events with a single unit repeat change at DYS437, DYS439, DYS635, DYS389II and DYS19, respectively, were identified using the Yfiler kit. The average mutation rate was estimated at 3.50 x 10(-3) per locus per generation. The cases with Y-STR mutation events in all tested confirmed father/son pairs for Yfiler system were 5.95% (5/84), which was significantly higher than that of Y-PLEX 6 (2.15%, 2/93) and "9 Y-STR multiplex with reduced-size amplicons" (no mutation events in the same 84 confirmed father/son pairs). It is concluded that the Yfiler kit which allowing simultaneous analysis of 17 Y-STR loci offers a high ability of discrimination for paternity testing, however, the Y-STR allelic mutation of the Yfiler system can not be neglected.

Molecular genetic analysis of Diego blood group Dia and Dib in Chinese Han population / 法医学杂志

OBJECTIVE@#To study the molecular genetic background of Diego blood group in Chinese Han population.@*METHODS@#A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing.@*RESULTS@#Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19.@*CONCLUSION@#Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.

Progress of research on biochemistry characteristics of cell-free fetal DNA in maternal plasma and its application / 中华医学遗传学杂志

Cell-free fetal DNA in maternal plasma of pregnant woman, originated from fetal and / or placental cells undergoing apoptosis, is mainly the short-sized DNA fragments of less than 313 base pairs in length for the sake of nuclear endonuclease selectively cleaving fetal DNA during the apoptosis process. The mean cell-free circulating fetal DNA in maternal plasma accounted for 3.4% and 6.2% of plasma total DNA during the early and the late gestation, respectively. Owing to its relative abundance, circulating fetal DNA in maternal plasma has now become the important DNA source for non-invasive prenatal molecular genetic diagnosis and it is widely used in fetal sex-determination, detection of fetal Rh (D) sequence in the plasma of the rhesus-negative woman, fetal aneuploidy detection, fetal STR genotyping and other clinical applications. Cell-free fetal DNA source, concentration, purity, size, distributions and postnatal clearance of fetal DNA in maternal plasma as well as the reported clinical applications are summarized and discussed in this paper. Based on the molecular characteristics of cell-free fetal DNA and the target gene, the using of appropriate molecular diagnosis strategy and experimental design as well as reducing the fragment size of PCR product and adjusting the PCR conditions to the optimum enable the improvement of non-invasive prenatal diagnosis accuracy.

Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.</p><p><b>METHODS</b>Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.</p><p><b>RESULTS</b>The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.</p><p><b>CONCLUSION</b>A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.</p>

The genetic polymorphisms of nine Y-STR loci with short fragment size alleles in southern Chinese Han population and its application in forensic science / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To study the genetic polymorphisms of 9 Y-chromosome specific STR loci that the allele size is less than 180 bp in length in the southern Chinese Han population, and to utilize the studied result to forensic science.</p><p><b>METHODS</b>Nine Y-STR loci were amplified by single multiplex PCR, and the PCR products were sequenced by using ABI Prism 3100 DNA Sequencer. The allele and haplotype frequencies at 9 Y-STR loci were determined in a total of 213 unrelated males from southern Chinese Han population. Eighty-four father/son pairs with demonstrated paternity and thirty-six non-paternity father/son pairs were detected by using our Y-STR multiplex system.</p><p><b>RESULTS</b>Three Y-STR alleles for DYS426, five alleles for DYS393, DYS460, DYS391 and DYS389 I respectively, six alleles for DYS456, seven alleles for both H4 and DYS388, and eight alleles for DYS458 loci were detected in 213 unrelated male individuals. Except for the DYS426 locus with a low GD value of 0.1489, the GD values for other 8 Y-STR loci ranged from 0.5064 to 0.9133. A total of 178 haplotypes were found at 9 Y-STR loci, of which 154 haplotypes were observed only once, and the haplotype diversity was 0.9983. None of Y-STR allele mutation was observed in the 84 father/son pairs with demonstrated paternity. Among the 36 non-paternity father/son pairs, two cases could get the paternity exclusions at 2 Y-STR loci; and the paternity of 33 cases could be ruled out by 3 or more Y-STR loci; only one case was found no exclusion of paternity regardless of detecting 9 Y-STR loci.</p><p><b>CONCLUSION</b>This result indicates that the 9 Y-STR loci with short fragment size alleles are highly polymorphic. The fluorescent multiplex amplification system that we developed is suitable for personal identification and paternity testing.</p>